Open Collections

UBC Faculty Research and Publications

MIA is a potential biomarker for tumour load in neurofibromatosis type 1 Kolanczyk, Mateusz; Mautner, Victor; Kossler, Nadine; Nguyen, Rosa; Kühnisch, Jirko; Zemojtel, Tomasz; Jamsheer, Aleksander; Wegener, Eike; Thurisch, Boris; Tinschert, Sigrid; Holtkamp, Nikola; Park, Su-Jin; Birch, Patricia; Kendler, David; Harder, Anja; Mundlos, Stefan; Kluwe, Lan Jul 4, 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12916_2011_Article_430.pdf [ 1.09MB ]
Metadata
JSON: 52383-1.0074620.json
JSON-LD: 52383-1.0074620-ld.json
RDF/XML (Pretty): 52383-1.0074620-rdf.xml
RDF/JSON: 52383-1.0074620-rdf.json
Turtle: 52383-1.0074620-turtle.txt
N-Triples: 52383-1.0074620-rdf-ntriples.txt
Original Record: 52383-1.0074620-source.json
Full Text
52383-1.0074620-fulltext.txt
Citation
52383-1.0074620.ris

Full Text

RESEARCH ARTICLE Open AccessMIA is a potential biomarker for tumour load inneurofibromatosis type 1Mateusz Kolanczyk1,2*, Victor Mautner3, Nadine Kossler1,2, Rosa Nguyen3, Jirko Kühnisch2, Tomasz Zemojtel4,Aleksander Jamsheer5,6, Eike Wegener1,2, Boris Thurisch1,2, Sigrid Tinschert7, Nikola Holtkamp8,9, Su-Jin Park9,Patricia Birch10, David Kendler11, Anja Harder12, Stefan Mundlos1,2,9 and Lan Kluwe3,13AbstractBackground: Neurofibromatosis type 1 (NF1) is a frequent genetic disease characterized by multiple benigntumours with increased risk for malignancy. There is currently no biomarker for tumour load in NF1 patients.Methods: In situ hybridization and quantitative real-time polymerase reaction were applied to investigateexpression of cartilage-specific genes in mice bearing conditional inactivation of NF1 in the developing limbs.These mice do not develop tumours but recapitulate aspects of NF1 bone dysplasia, including deregulation ofcartilage differentiation. It has been recently shown that NF1 tumours require for their growth the master regulatorof cartilage differentiation SOX9. We thus hypothesized that some of the cartilage-specific genes deregulated in anNf1Prx1 mouse model might prove to be relevant biomarkers of NF1 tumours. We tested this hypothesis byanalyzing expression of the SOX9 target gene product melanoma-inhibitory activity/cd-rap (MIA) in tumour andserum samples of NF1 patients.Results: Increased expression of Mia was found in Nf1-deficient cartilage in mice. In humans, MIA was expressed inall NF1-related tumours and its serum levels were significantly higher in NF1 patients than in healthy controls.Among NF1 patients, MIA serum levels were significantly higher in those with plexiform neurofibromas and inthose with large number of cutaneous (> 1,000) or subcutaneous (> 100) neurofibromas than in patients withoutsuch tumours. Most notably, MIA serum levels correlated significantly with internal tumour burden.Conclusions: MIA is a potential serum biomarker of tumour load in NF1 patients which could be useful infollowing the disease course and monitoring the efficacy of therapies.BackgroundNeurofibromatosis type 1 (NF1) is a genetic disorderresulting from mutations in the NF1 tumour suppressorgene. Susceptibility to neoplastic transformation is themain feature of the disease [1]. The most frequent tumoursin NF1 are dermal neurofibromas, which can be found inmore than 90% of adult patients [2]. Approximately 50% ofNF1 patients develop plexiform neurofibromas (pNFs),which can undergo malignant transformation into malig-nant peripheral nerve sheath tumours (MPNSTs) [3-6].MPNSTs are highly malignant tumours with a poorprognosis. The lifetime risk of developing MPNSTs in theNF1 patient is 8% to 13% [7].Major challenges in clinical practice are to determinetumour burden and to monitor the disease course. Whilecutaneous neurofibromas are visible on physical exami-nation, the diagnosis of pNFs, especially internal ones,depends on magnetic resonance imaging (MRI), which iscostly and laborious. Furthermore, early diagnosis is cru-cial for complete resection of MPNSTs, which is up tonow the only curative treatment [8]. A biomarker forassessment of tumour burden and detection of malignanttransformation would therefore be of interest.Previously, we and others have shown that loss of Nf1gene function during murine embryogenesis causesdefects of bone and cartilage development [9,10]. One ofthe observed molecular changes in Nf1-deficient* Correspondence: kolanshy@molgen.mpg.de1Institute of Medical Genetics, Charité, Universitätsmedizin Berlin, HumboldtUniversity, Augustenburger Platz 1, D-13353 Berlin, GermanyFull list of author information is available at the end of the articleKolanczyk et al. BMC Medicine 2011, 9:82http://www.biomedcentral.com/1741-7015/9/82© 2011 Kolanczyk et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.embryonic cartilage was an upregulation and persistentlynuclear localization of the transcription factor SOX9.Interestingly, SOX9 was also recently found to beexpressed in NF1-related tumours, where it supports cel-lular survival [11]. As a master regulator of cartilage dif-ferentiation, SOX9 regulates expression of variousdownstream target genes, including collagen type 2a1,collagen type 11a2, aggrecan and melanoma-inhibitoryactivity (MIA). The last, MIA, is also known as cartilage-derived retinoic acid sensitive protein (cd-rap) and wasoriginally isolated as a secretory factor from supernatantsof melanoma cell cultures [12]. MIA serum level wasfound to correlate with melanoma spreading [13] andwas proposed as a biomarker for monitoring the courseof disease and the efficacy of therapies [14]. Variousother tumours, predominantly those of neuroectodermal,glial origin, also express MIA [15]. Recombinant MIAinhibits melanoma cell growth and cell attachment invitro [16]. Subsequent studies revealed that MIA interactswith extracellular matrix components, laminin and fibro-nectin, as well as with cellular matrix receptors integrina5, integrin a4 [17] and cadherin 7 [18].In the present study, we examined expression of MIAin Nf1-deficient mouse cartilage, in human cutaneousand plexiform neurofibromas and MPNSTs, and in seraof NF1 patients with these tumours. MIA in the serumof healthy probands was examined as a control.MethodsMouse breeding and tissue processingThe mice were continuously back-crossed to wild-typeC57BL/6J to minimize the variation of genetic back-ground. The female Nf1flox mice were crossed to maleNf1flox heterozygous Prx1-Cre-positive males and the off-spring genotyped as previously described [9]. Embryos andpostnatal tissue samples were fixed overnight at 4°C in 4%paraformaldehyde, dehydrated through an ethanol/xylolseries, and embedded in paraffin blocks. Six-micrometersections were cut and processed for haematoxylin andeosin/Alcian blue staining and in situ hybridization.Patients and samplesThe study was conducted with a cohort of 42 NF1patients and 22 healthy individuals. The diagnosis of NF1was made using National Institutes of Health criteria.The study protocol was approved by the local institu-tional review board, and all patients gave their informedconsent. Cutaneous and subcutaneous tumours werecounted or estimated in case the number was larger than100. Plexiform neurofibromas, including internal ones,were detected by means of whole-body MRI in 30 of the42 patients. Because of the limited resolution of whole-body MRI, lesions smaller than 3 cm in the longest dia-meter, which is often the case for spinal tumours, werenot included. Tumour sizes were calculated using a semi-automated volumetric method, and the total internaltumour load was obtained subsequently, including PNs(Plexiform Neurofibromas), spinal tumours and internalnodule neurofibromas, but excluding cutaneous and sub-cutaneous tumours [19]. An age effect for cutaneous,subcutaneous and internal tumours was examined usinga nonparametric Spearman’s rank-correlation test.All serum samples were prepared using a standardizedprotocol in the laboratory of the Department of Maxillo-facial Surgery at the University Medical Center Ham-burg-Eppendorf. Whole blood of each patient was kept atroom temperature for 30 minutes before being spundown at 4,500 rpm for 10 minutes using a benchtop cen-trifuge. The supernatant was stored at -80°C in 100-μLaliquots.In situ hybridizationIn situ hybridization was performed on paraffin sectionsaccording to standard protocol [9]. Images were col-lected using a DMR HC microscope (Leica, Wetzlar,Germany) equipped with an AxioCam HRc camera(Zeiss, Jena, Germany) and evaluated using AxioVision4.1 software (Zeiss, Jena, Germany).Immunohistochemical detection of MIASections of six cutaneous and three plexiform neurofibro-mas, as well as seven MPNSTs, from a total of sixteenNF1 patients were stained with monoclonal anti-humanMIA antibody (R&D Systems, McKinley Place NE, Min-neapolis) diluted at 1:40. Sections were boiled in citratebuffer (pH 6.1) for antigen retrieval. The streptavidin-bio-tin method was performed using an automated stainingsystem TechMate (Dako, Hamburg, Germany) with animplemented counterstaining. Negative controls were car-ried out with normal serum without the primary antibodyor with antibody preincubated in access (25 ng/μl) ofrecombinant human MIA (Peprotech GmbH, Hamburg,Germany). Stained sections were analyzed using the BX51microscope (Olimpus, Hamburg, Germany) and analySIS5.0 software (Soft imaging system GmbH, Münster,Germany).Quantitative real-time polymerase chain reactionRNA was isolated from the knee cartilage of two wild-typeand two Nf1Prx1 mice using peqGOLD TriFast (PeqLabBiotechnologie GmbH, Erlangen, Germany) according tothe supplied protocol. cDNA was synthesized from 1 μg oftotal RNA with MuLV Reverse Transcriptase (AppliedBiosystems, Carlsbad, CA, USA). TaqMan Universal PCRMaster Mix was then performed on an ABI PRISM 7900Cycler (Applied Biosystems) using the SYBR Greenmethod (Invitrogen, Darmstad, Germany) according to themanufacturer’s instructions. The expression level of MiaKolanczyk et al. BMC Medicine 2011, 9:82http://www.biomedcentral.com/1741-7015/9/82Page 2 of 7was determined in Nf1Prx1 and wild-type tissues and wasequilibrated against expression of glyceraldehyde 3-phos-phate dehydrogenase (GAPDH). The following primerswere used: mGAPDH: 5’ GGGAAGCCCATCACCATCTT 3’, 5’ CGGCCTCACCCCATTTG 3’; mMIA: 5’GGAGGACCTGACTCTGAAACC 3’; 5’ ACTGCAGG-GATAGCGGTAG 3’.Mia elisaThe MIA ELISA kit was purchased from (Roche Diag-nostics, Indianapolis, IN, USA) and the measurementswere conducted in duplicate according to the suppliedprotocol. Internal negative and positive quality controlswere provided in each enzyme-linked immunosorbentassay (ELISA) kit and were run in triplicate in eachassay.ResultsMia expression is elevated in Nf1-deficient murinecartilageIn situ hybridization revealed expression of Mia in thecartilage of the E14.5 to E15.5 mouse embryo (Figure 1).Expression domains of Sox9, Col2a and Mia overlappedand, in the E14.5 embryo sections, demarcated cartilageanlagen of the future bones (Figure 1A). The expressionof Mia was found to be more intensive in the NF1-defi-cient cartilage of the Nf1Prx1 mice (Figure 1B). Similarresults were obtained with mouse embryos bearing carti-lage-specific inactivation of Nf1 (data not shown). Wenext quantified Mia expression by performing quantita-tive real-time polymerase chain reaction (qRT-PCR).Absolute quantification was conducted on the RNA iso-lated from knee cartilage of two mutant and two controlmice at P4. Mia transcript levels in Nf1-deficient tissuewere compared to the wild-type tissue and normalizedto GAPDH expression. qRT-PCR revealed a more thantwofold increase of Mia expression in Nf1Prx1-deficientcartilage.MIA is expressed in NF1-associated tumoursMIA was immunohistochemically detected on the paraf-fin sections of six cutaneous and three plexiform neuro-fibromas and in seven MPNSTs from NF1 patients. Thetypical pattern of MIA staining was a mixture of positiveand negative nuclei side-by-side (Figure 2). The propor-tion of MIA-positive cells varied between 50% and 90%.The most intense staining was obtained in MPNSTs,which, however, represents the high density of nuclei inthis type of tumour. No morphological difference wasobserved between MIA-positive and MIA-negative cells.On the basis of the degenerative nuclear atypia ofSchwann cells, we deduced that MIA was both positiveand negative in Schwann cell nuclei. MIA-positive cellswere more often seen in areas of spindle-shaped cellsarranged in fascicles.Serum concentration of MIA in NF1 patients correlateswith tumour loadMIA serum level was determined in the 42 NF1 patientsand in 22 healthy individuals. The patients’ ages rangedfrom 14 to 72 years (mean age, 36 years). The controlgroup’s ages ranged between 19 and 67 years (mean age,40 years). An age effect was seen in the NF1 patients forthe number of cutaneous tumours (P = 0.023), but notfor subcutaneous tumours (P = 0.842) or internaltumours (P = 0.449). Additionally, linear regression ana-lysis revealed an association between total internalFigure 1 Elevated expression of cd-rap/Mia in the Nf1-deficient cartilage. (A) In situ hybridization of the melanoma-inhibitory activity/cd-rap(mia)-specific riboprobe on the transverse sections of E14.5 Nf1Prx1 embryos. Intensity of staining reflects abundance of Mia transcript. (B)Quantitative real-time polymerase chain reaction (qRT-PCR) of Mia transcript in the postnatal day 4 knee joints. Data represent means (± SD) ofduplicate absolute quantifications for each probe. Transcript of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH)was used as control.Kolanczyk et al. BMC Medicine 2011, 9:82http://www.biomedcentral.com/1741-7015/9/82Page 3 of 7Figure 2 MIA is expressed in NF1 tumors. Immunohistochemical detection of MIA on paraffin sections of NF1-associated tumors. Melanomasamples were used as positive controls. MIA is expressed in each type of the analysed NF1 tumors. Malignant peripheral nerve sheath tumours(MPNSTs) have higher cellular density, yielding more MIA-positive cells per visual field.Kolanczyk et al. BMC Medicine 2011, 9:82http://www.biomedcentral.com/1741-7015/9/82Page 4 of 7Figure 3 MIA is elevated in serum from NF1 patients and reflects the internal tumor load. (A) MIA serum levels in 42 NF1 patients and 22healthy controls. (B) The 42 NF1 patients divided into subgroups according to the absence (-) or presence (+) of pNFs or MPNSTs. (C, D) The 42NF1 patients were further divided with accordingt to cutaneous and subcutaneous tumors load. (E) In 30 of the 42 NF1 patients, internal tumorload was determined by whole-body magnetic resonance imaging (MRI). The 30 patients were arbitrarily divided into four groups according tothe total tumor load: 0 to 100 mL (n = 16), < 350 mL (n = 5), < 1,000 mL (n = 5) and > 1,000 mL (n = 4). Differences between groups wereevaluated using an unpaired t-test (A and B) or one-way analysis of variance (ANOVA) with a post hoc t-test including the Bonferroni correction(C to E). **P < 0.01. ***P < 0.001. The linear regression analysis revealed a positive correlation between the logarithm of internal tumor load andMIA serum concentration.Kolanczyk et al. BMC Medicine 2011, 9:82http://www.biomedcentral.com/1741-7015/9/82Page 5 of 7tumour load and the number of subcutaneous tumours(P value 8.19E-17 for the F test), but not between internaltumour load and the number of cutaneous tumours.MIA serum concentration was independent of age andsex (data not shown), but was significantly higher in NF1patients than in healthy controls: 15.16 ± 1.26 pg/mL ver-sus 4.54 ± 0.40 pg/mL (P < 0.001, unpaired t-test withWelch’s correction) (Figure 3A). Among the 42 NF1patients, the 27 patients with pNFs had significantlyhigher MIA serum concentration than the 15 patientswithout those tumours (P = 0.032) (Figure 3B). However,no significant difference in MIA serum level was foundbetween the 7 and 35 patients with and withoutMPNSTs, respectively (Figure 3B). MIA serum level wasalso significantly higher in the nine and seven patientswith > 100 subcutaneous neurofibromas and > 1,000cutaneous neurofibromas, respectively, than in thosewithout such tumours (Figures 3C and 3D). Internaltumour load was determined for 30 of the 42 NF1patients on the basis of whole-body MRI. The patientswere divided into four groups: very low internal tumourloads (0 to 100 mL; n = 16), low internal tumour loads (<350 mL; n = 5), moderate internal tumour loads (< 1,000mL; n = 5) and high internal tumour loads (> 1,000 mL;n = 4) (Figure 3E, left). One-way analysis of variance withthe Bonferroni multiple comparison test revealed signifi-cant differences between MIA serum levels in patientswith very low internal tumour loads and groups withhigh and very high internal tumour loads (**P < 0.01,***P < 0.001). Also, linear regression analysis revealed anassociation between the total internal tumour load andMIA serum level (P value of 1.95E-7 for the F-test). Theline that best predicts MIA level from values of logarithmof internal tumor load volume was identified by regres-sion analysis: R2 = ~0.64 (Figure 3E, right). These dataindicate that elevated MIA serum level may be indicativeof an increased internal tumour burden. Since weobserved an association between total internal tumourload and the number of subcutaneous tumours, a studyinvolving a larger cohort size is necessary to reveal therelative contributions of internal, subcutaneous and pos-sibly also cutaneous tumours to elevated MIA levels.DiscussionIn this study, we found increased Mia expression in Nf1-deficient cartilage of Nf1Prx1 mice where SOX9 expres-sion and nuclear localization were previously shown [9].MIA promoter was previously shown to be regulated bySOX9 in a dose-dependent manner in cultured chondro-cytes [20]. It thus appears likely that MIA expression inNF1 tumours is also regulated by SOX9, as this transcrip-tion factor was reported to be required for the survival ofMPNST cells [11]. Our finding of MIA expression in var-ious NF1-related tumours is consistent with the findingsof previous reports that MIA is expressed in glialtumours [15].The major finding of the present study is that MIAserum levels correlate with the internal tumour load inNF1 patients. Provided that this correlation can be con-firmed in a larger cohort of NF1 patients, MIA wouldbe a valuable biomarker for the internal tumour load.In malignant melanoma cells, MIA was shown to bindintegrin a5 and reduce ERK activity [17]. MIA/cad-herin-7 interactions were shown to regulate cell-celladhesion of malignant melanoma cells, influencing theirmigration [18]. It was also reported that MIA augmen-ted transforming growth factor-b-mediated chondro-genic differentiation of human mesenchymal cells invitro [21] and inhibited articular cartilage mineralizationin vivo [22]. It will be interesting to examine whetherany of these effects of MIA play a role in NF1-relatedtumorigenesis and skeletal dysplasia. While more studiesare needed to understand the contribution of MIA toNF1 pathology, the presented correlation of MIA serumlevel with the internal tumour load suggests that it is apromising candidate as a biomarker of the tumour loadin NF1.ConclusionsMIA is a potential biomarker of tumour load in NF1patients and should be further evaluated for applicationin monitoring the clinical course and therapy outcomesof patients.AcknowledgementsMK and NK were supported by the Young Investigator Award from theChildren’s Tumour Foundation (New York, NY), grant 2007-01-038, and byBundesministerium für Bildung und Forschung (BMBF) grant NF1-01GM0844(to MK, SM and VFM). This study was in part supported by the US Army NF043115 (to VFM) and Rudolph-Bartling-Stiftung II/85 (to VFM and AK). LK wassupported in part by BMBF grant 01GM0841. This work was also supportedby the Sixth Framework of the European Commission, EuroGrow ProjectLSHM-CT-2007-037471, and by a grant from Berlin-Brandenburg Center forRegenerative Therapies ("Optimisation and application of a mouse corticalinjury system for the survey of new bone anabolic therapies and deliverysystems"; Platform A nr-30). We thank Monika Osswald and Carola Dietrichfor excellent technical assistance. We want to acknowledge Ms. JessicaKnoblauc for her technical assistance, especially in preparing patient sera.Author details1Institute of Medical Genetics, Charité, Universitätsmedizin Berlin, HumboldtUniversity, Augustenburger Platz 1, D-13353 Berlin, Germany. 2Developmentand Disease Group, Max Planck Institute for Molecular Genetics, Ihnestrasse63-73, D-14195 Berlin, Germany. 3Department of Oral and MaxillofacialSurgery, Department of Neurology, University Hospital Hamburg-Eppendorf,Martinistrasse 52, D-20246 Hamburg, Germany. 4Department ofComputational Molecular Biology, Max Planck Institute for MolecularGenetics, Ihnestrasse 63-73, D-14195 Berlin, Germany. 5Center for MedicalGenetics in Poznań, ul. Grudzieniec 4, 60-601 Poznań, Poland. 6Departmentof Medical Genetics, Medical University of Poznan, 60-352 Poznań, Poland.7Institut für Klinische Genetik, Medizinische Fakultät Carl Gustav Carus,Technische Universität Dresden, Fetscherstrasse 74, 01307 Dresden, Germany.8Institute of Neuropathology, Charité-Universitätsmedizin Berlin, CVK,Augustenburger Platz 1, D-13353 Berlin, Germany. 9Berlin Center forRegenerative Therapies, Charité-Universitätsmedizin Berlin AugustenburgerKolanczyk et al. BMC Medicine 2011, 9:82http://www.biomedcentral.com/1741-7015/9/82Page 6 of 7Platz 1, D-13353 Berlin, Germany. 10Department of Medical Genetics,University of British Columbia, Box 153, 4500 Oak Street, Vancouver, BC V6H3N1, Canada. 11Faculty of Medicine, University of British Columbia 600 - 1285West Broadway Vancouver, BC V6H 3X8, Canada. 12Institute ofNeuropathology, University Hospital Münster, Domagkstrasse 19, D-48149Münster, Germany. 13German Cancer Research Center, Im Neuenheimer Feld,D-69120 Heidelberg, Germany.Authors’ contributionsMK formulated the hypothesis, coordinated the study, evaluated data andconceived the manuscript. VM provided clinical data and specimens. NKperformed MIA ELISA measurements. RN performed whole-body MRIevaluations. JK provided expertise on the ELISA system handling and dataacquisition. TZ performed statistical analysis. AJ helped in establishing theMIA immunohistochemistry protocol. EW performed real-time PCRexperiments. BT performed in situ hybridization analysis. ST provided NF1tumour samples and sera. NH provided logistical support and helped incollection of the serum samples. SP helped in collection of the serumsamples. PB provided logistical support and helped in collection of theserum samples. DK provided support in obtaining serum probes andcritically revised the manuscript. AH performed histological andimmunohistological analysis of the surgically removed tumour material. SMcritically revised the manuscript. LK coordinated clinical data and specimenacquisition, was involved in the evaluation and interpretation of data, andconceived and critically revised the manuscript. All authors read andapproved the final manuscript.Competing interestsThe authors declare that they have no competing interests.Received: 11 January 2011 Accepted: 4 July 2011 Published: 4 July 2011References1. Rasmussen SA, Friedman JM: NF1 gene and neurofibromatosis 1. Am JEpidemiol 2000, 151:33-40.2. Le LQ, Shipman T, Burns DK, Parada LF: Cell of origin andmicroenvironment contribution for NF1-associated dermalneurofibromas. Cell Stem Cell 2009, 4:453-463.3. Evans DG, Baser ME, McGaughran J, Sharif S, Howard E, Moran A: Malignantperipheral nerve sheath tumours in neurofibromatosis 1. J Med Genet2002, 39:311-314.4. Helman LJ, Meltzer P: Mechanisms of sarcoma development. Nat RevCancer 2003, 3:685-694.5. Zoller ME, Rembeck B, Oden A, Samuelsson M, Angervall L: Malignant andbenign tumors in patients with neurofibromatosis type 1 in a definedSwedish population. Cancer 1997, 79:2125-2131.6. Mautner VF, Asuagbor FA, Dombi E, Fünsterer C, Kluwe L, Wenzel R,Widemann BC, Friedman JM: Assessment of benign tumor burden bywhole-body MRI in patients with neurofibromatosis 1. Neuro Oncol 2008,10:593-598.7. Mashour GA, Driever PH, Hartmann M, Drissel SN, Zhang T, Scharf B,Felderhoff-Müser U, Sakuma S, Friedrich RE, Martuza RL, Mautner VF,Kurtz A: Circulating growth factor levels are associated withtumorigenesis in neurofibromatosis type 1. Clin Cancer Res 2004,10:5677-5683.8. Korf BR: Malignancy in neurofibromatosis type 1. Oncologist 2000,5:477-485.9. Kolanczyk M, Kossler N, Kühnisch J, Lavitas L, Stricker S, Wilkening U,Manjubala I, Fratzl P, Spörle R, Herrmann BG, Parada LF, Kornak U,Mundlos S: Multiple roles for neurofibromin in skeletal development andgrowth. Hum Mol Genet 2007, 16:874-886.10. Elefteriou F, Benson MD, Sowa H, Starbuck M, Liu X, Ron D, Parada LF,Karsenty G: ATF4 mediation of NF1 functions in osteoblast reveals anutritional basis for congenital skeletal dysplasiae. Cell Metab 2006,4:441-451.11. Miller SJ, Jessen WJ, Mehta T, Hardiman A, Sites E, Kaiser S, Jegga AG, Li H,Upadhyaya M, Giovannini M, Muir D, Wallace MR, Lopez E, Serra E,Nielsen GP, Lazaro C, Stemmer-Rachamimov A, Page G, Aronow BJ,Ratner N: Integrative genomic analyses of neurofibromatosis tumoursidentify SOX9 as a biomarker and survival gene. EMBO Mol Med 2009,1:236-248.12. Blesch A, Bosserhoff AK, Apfel R, Behl C, Hessdoerfer B, Schmitt A,Jachimczak P, Lottspeich F, Buettner R, Bogdahn U: Cloning of a novelmalignant melanoma-derived growth-regulatory protein, MIA. Cancer Res1994, 54:5695-5701.13. Vucetić B, Rogan SA, Hrabac P, Hudorović N, Cupić H, Lukinac L,Ledinsky M, Matejcić A, Lovricević I, Zekan M: Biological value ofmelanoma inhibitory activity serum concentration in patients withprimary skin melanoma. Melanoma Res 2008, 18:201-207.14. Stahlecker J, Gauger A, Bosserhoff A, Büttner R, Ring J, Hein R: MIA as areliable tumor marker in the serum of patients with malignantmelanoma. Anticancer Res 2000, 20:5041-5044.15. Hau P, Apfel R, Wiese P, Tschertner I, Blesch A, Bogdahn U: Melanoma-inhibiting activity (MIA/CD-RAP) is expressed in a variety of malignanttumors of mainly neuroectodermal origin. Anticancer Res 2002,22:577-583.16. Bosserhoff AK, Stoll R, Sleeman JP, Bataille F, Buettner R, Holak TA: Activedetachment involves inhibition of cell-matrix contacts of malignantmelanoma cells by secretion of melanoma inhibitory activity. Lab Invest2003, 83:1583-1594.17. Bauer R, Humphries M, Fassler R, Winklmeier A, Craig SE, Bosserhoff AK:Regulation of integrin activity by MIA. J Biol Chem 2006, 281:11669-11677.18. Winklmeier A, Contreras-Shannon V, Arndt S, Melle C, Bosserhoff AK:Cadherin-7 interacts with melanoma inhibitory activity protein andnegatively modulates melanoma cell migration. Cancer Sci 2009,100:261-268.19. Cai W, Kassarjian A, Bredella MA, Harris GJ, Yoshida H, Mautner VF,Wenzel R, Plotkin SR: Tumor burden in patients with neurofibromatosistypes 1 and 2 and schwannomatosis: determination on whole-body MRimages. Radiology 2009, 250:665-673.20. Xie WF, Zhang X, Sakano S, Lefebvre V, Sandell LJ: Trans-activation of themouse cartilage-derived retinoic acid-sensitive protein gene by Sox9. JBone Miner Res 1999, 14:757-763.21. Tscheudschilsuren G, Bosserhoff AK, Schlegel J, Vollmer D, Anton A, Alt V,Schnettler R, Brandt J, Proetzel G: Regulation of mesenchymal stem celland chondrocyte differentiation by MIA. Exp Cell Res 2006, 312:63-72.22. Schubert T, Schlegel J, Schmid R, Opolka A, Grassel S, Humphries M,Bosserhoff AK: Modulation of cartilage differentiation by melanomainhibiting activity/cartilage-derived retinoic acid-sensitive protein (MIA/CD-RAP). Exp Mol Med 2010, 42:166-174.Pre-publication historyThe pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1741-7015/9/82/prepubdoi:10.1186/1741-7015-9-82Cite this article as: Kolanczyk et al.: MIA is a potential biomarker fortumour load in neurofibromatosis type 1. BMC Medicine 2011 9:82.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitKolanczyk et al. BMC Medicine 2011, 9:82http://www.biomedcentral.com/1741-7015/9/82Page 7 of 7

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0074620/manifest

Comment

Related Items